Mo. sex assault case expected to get fresh start

This photo taken on Thursday, Oct. 17, 2013 shows the house in Maryville, Missouri that was burned while Melinda Coleman was trying to sell it. A 14-year-old girl who says she was raped by an older boy from her school could get another chance to bring the case to court after a prosecutor criticized for his handling of the case asked that a special prosecutor review the allegations. The girl's mother, Melinda Coleman, claims justice was denied when prosecutor Robert Rice dropped felony charges in March 2012, two months after she says her daughter was plied with alcohol, raped, then dumped on the family's front porch in sub-freezing temperatures. (AP Photo/Carrie Antlfinger)

This photo taken on Thursday, Oct. 17, 2013 shows the house in Maryville, Missouri that was burned while Melinda Coleman was trying to sell it. A 14-year-old girl who says she was raped by an older boy from her school could get another chance to bring the case to court after a prosecutor criticized for his handling of the case asked that a special prosecutor review the allegations. The girl's mother, Melinda Coleman, claims justice was denied when prosecutor Robert Rice dropped felony charges in March 2012, two months after she says her daughter was plied with alcohol, raped, then dumped on the family's front porch in sub-freezing temperatures. (AP Photo/Carrie Antlfinger)

This photo taken on Thursday, Oct. 17, 2013 shows the house in Maryville, Missouri that was burned while Melinda Coleman was trying to sell it. A 14-year-old girl who says she was raped by an older boy from her school could get another chance to bring the case to court after a prosecutor criticized for his handling of the case asked that a special prosecutor review the allegations. The girl's mother, Melinda Coleman, claims justice was denied when prosecutor Robert Rice dropped felony charges in March 2012, two months after she says her daughter was plied with alcohol, raped, then dumped on the family's front porch in sub-freezing temperatures. (AP Photo/Carrie Antlfinger)

Melinda Coleman listens to a question during an interview in her home in Albany, Mo., Wednesday, Oct. 16, 2013. Coleman says justice was denied when charges were dropped against the boys that her 14-year-old daughter said sexually assaulted her and a 13-year-old friend. (AP Photo/Orlin Wagner)

County prosecutor Robert Rice, left, and Sheriff Darren White, back, hold a news conference outside the Nodaway County Court House in Maryville, Mo., Wednesday, Oct. 16, 2013. Rice announced that he's asking for a special prosecutor to look at the case of a 14-year-old girl who says she was plied with alcohol and raped by a 17-year-old acquaintance. (AP Photo/Orlin Wagner)

County prosecutor Robert Rice, right, and Sheriff Darren White hold a news conference outside the Nodaway County Court House in Maryville, Mo., Wednesday, Oct. 16, 2013. (AP Photo/Orlin Wagner)

MARYVILLE, Mo. (AP) — The case of a 14-year-old girl who says she was raped by an older boy from her Missouri high school and left passed out on her porch in freezing temperatures is expected to get a fresh start under a special prosecutor.

A special prosecutor will be able to launch his own investigation, interview witnesses and work independently from the local prosecutor who's faced intense scrutiny for dropping felony charges in the case last year, experts said Thursday.

"The idea is really to have a third party who is removed from the process, who can bring the appearance of objectivity and neutrality," said Richard Reuben, a professor at the University of Missouri School of Law. "At the end of the day they would look like a prosecutor who is truly independent."

The new prosecutor's final decision carries high stakes: It could settle the debate over whether Rice was right to drop the charges, or validate the accusers' outrage by pushing the case toward a trial.

Nodaway County prosecutor Robert Rice filed a motion Thursday for a judge to appoint a special prosecutor in the case, which has gained new attention and an outpouring of responses of social media following a Kansas City Star investigation. The girl's family also spoke out this summer to Kansas City radio station KCUR.

The case and the publicity has shaken the small college town of Maryville, where the girl's mother, Melinda Coleman, said her family was forced to move after being harassed over the allegations. Her house in Maryville burned down while the family was trying to sell it, but a cause hasn't been determined.

Coleman, was outraged when Rice dropped felony charges in March 2012, two months after she says her daughter was plied with alcohol, raped, then dumped on the family's front porch. She said her daughter's 13-year-old friend was raped by another boy the same evening.

"I think it's really good that we have a chance to have someone listen objectively," Coleman said Thursday. "That brings a lot of healing in itself."

Rice insists the initial investigation collapsed after the Colemans became uncooperative with investigators — something Coleman has denied.

Anchored by Northwest Missouri State University, Maryville may be best known as a football town, illustrated by the giant "bearcat" paw prints painted on Fourth Street and leading the way to the university's football stadium. Signs in the windows of local shops and bars support the Bearcats, whose annual game against rival Pittsburg State University is so big it's played at Arrowhead Stadium in Kansas City and dubbed the Fall Classic.

Since the Star's story was published, the town has been deluged with negative reactions, most of it coming from people on social media who have condemned the town for seemingly abandoning sexual assault victims. The case now is the talk of the town, and locals are anxious for a resolution.

"I have some friends who get together, but since this has been going on, they have to sit and argue their opinions," said Kyle Ponder, a 22-year-old lifelong Maryville resident. "This is splitting the town in two."

Few have disputed the central facts of the case. Daisy Coleman was 14 on the night in January 2012 she and 13-year-old friend drank alcohol they stashed in a closet, sneaked out of the Colemans' Maryville home and met with three boys, including two 17-year-olds.

Daisy's mother says one of the older boys sexually assaulted her daughter while the girl was passed out, while the 15-year-old boy forced the 13-year-old to have sex in a different room. The second 17-year-old was accused of recording the incident involving Daisy on his cellphone.

The two older boys were initially charged as adults with felonies, while the younger boy's case was handled in the juvenile system. Months later, Rice dropped all the charges against the older boys, saying the victims had invoked their Fifth Amendment right against self-incrimination. The boys have insisted the sex act involving Daisy Coleman was consensual.

Authorities say the cellphone video had been deleted and investigators at the regional forensics lab in Kansas City could not recover it from the cellphone.

The Associated Press does not generally name victims of sexual assault but is naming the Colemans because they have been granting public interviews about the case. The AP is not naming the accused boys because there are no active charges against them.

Rice says he's asking for a special prosecutor only because media stories have questioned the integrity of the county's justice system. He stands by claims that the case fell apart only after the Colemans and the other girl refused to answer questions.

A special prosecutor could seek to interview the original prosecutor as a witness in the case but would conduct an entirely separate investigation. A special prosecutor would investigate if there's been a crime and would have the authority to bring charges, said Reuben, the professor at the University of Missouri.

Platte County Prosecutor Eric Zahnd said special prosecutors are used often in Missouri. Zahnd, who has asked for special prosecutors and has also served as a special prosecutor, said the designation in Nodaway County could be given to any other lawyer in the state, including another county prosecutor or someone from the Missouri Attorney General's Office.

About a block off of Maryville's town square, Fred Robertson was cutting hair Thursday at his barbershop when the case came up. Robertson said it's sad that the town has been caught up in the media spotlight for something most people had nothing to do with.

"You can work all your life to have something good, and something like this can tear it up in a short time," he said. "There are no winners."

___

Maria Sudekum contributed to this report from Kansas City, Mo.

Associated PressSource: http://hosted2.ap.org/APDEFAULT/386c25518f464186bf7a2ac026580ce7/Article_2013-10-17-US-Missouri-Teen-Sex-Assault/id-b69ae764f691480fa85bc6825db91848
Similar Articles: jennette mccurdy   september 11   Robocop   Eydie Gorme   Huntington Beach riot  

Adidas Trots Out Smartwatch for Runners

Adidas has entered the smartwatch race, but it's not trying to produce the best smartwatch. It claims its miCoach Smart Run is the best running watch. However, the pricey $400 device is already drawing barbs. "I'd rate it as a fashion accessory for people who want to look like they're working out, rather than a serious fitness tool," said Tellus Venture Associates' Stephen Blum.

Adidas on Wednesday introduced the miCoach Smart Run, its new fitness-based smartwatch for runners, just a day after rival Nike introduced the latest update to its own Nike+ Fuelband SE tracker.

Fjord collaborated with Adidas on the design.

Paul Gaudio, vice president of Adidas Interactive, demonstrated the new fitness tracker at the GigaOM Mobile 2013 conference in San Francisco. The GPS-equipped device can track a runner's location, along with speed and heart rate. It's also equipped with onboard flash memory to store music. The Smart Run will be available Nov. 1 for US$399.

Wearers can opt to receive coaching, which is based on heart rate, with prompts appearing on the watchface or sent via Bluetooth to headphones.

The Smart Run does not connect with a mobile phone, however.

Adidas maintains that it is not looking to produce the best smartwatch -- but rather, the best running watch.

Wearable Devices Market Set to Go

Adidas' announcement also comes just days after Juniper Research's release of its "Smart Wearable Devices: Fitness, Healthcare, Entertainment & Enterprise: 2013-2018" report, which predicts that the total retail revenue from wearable devices will reach $19 billion by 2018, up from just $1.4 billion this year.

Revenues will be driven by higher price points, along with strong market demand. This could be why companies such as Adidas are entering this race.

The Adidas watch could replace more passive bands, especially for serious athletes.

"Watches that are specifically geared towards athletes and extreme athletes -- as opposed to bands that are helping people wanting to set healthy fitness habits -- are a niche market and a trend to watch for in 2014 and 2015," Julie Sylvester, producer of Sports & Fitness Tech Summit at CES, told TechNewsWorld.

"At present, smartwatches represent a niche market with no significant adoption or shipment numbers to demonstrate," added Nitin Bhas, senior analyst at Juniper Research and author of the recent smart wearable devices study.

"The emergence of such players means that there will be a demand for smartwatches as an accessory to smartphones, at least from a certain consumer segment or demographic," he said.

"However, the mobile fitness market is limited by the size of the fitness market itself, which as a subset of the leisure industry, is relatively smaller," Bhas told TechNewsWorld.

"If the success of the market is born of the fact that those interested in the market are motivated and therefore keen to quantify their own fitness," he explained, "its limitation is that the number of people with such motivation represent a small proportion of the population at large."

Fitness at a Premium

However, as the Adidas device carries a $400 price, it could be aimed at the most serious consumers who don't mind paying a premium.

"Sports brands are likely strong in the health peripherals market and might well command a premium," said Roger L. Kay, principal analyst with Endpoint Technologies Associates.

"The $400 isn't that far above comparable offerings. Galaxy Gear is $300, and Qualcomm's Toq is rumored to be $300-350 without headphones," he pointed out.

"Why shouldn't Adidas test the waters and see they can make a go of it?" Kay pondered.

Still, $400 may be too high a price given the more-affordable options, especially those from brands established in the space.

"It's a head scratcher," said Stephen Blum, principal analyst at Tellus Venture Associates. "Garmin has had GPS watches for years, with price points now near $100."

Not So Smart

It's also uncertain whether the Adidas device even measures up to the competition.

"What I've seen indicates that the Adidas watch reads heart rate from the pulse on your wrist, which is less reliable than the chest sensors that dedicated heart rate monitors use," Blum told TechNewsWorld.

"I'd rate it as a fashion accessory for people who want to look like they're working out, rather than a serious fitness tool," he scoffed.

"And I wouldn't call it a smartwatch," Blum added. "It's a high-end sports watch. It has standalone built-in functions that can be found in plenty of other products. It does not interact with smartphones or have wireless networking capability or support apps, either on board or via a wireless connection to another device. My prediction is that athletes who find one of these in their Christmas stocking will end up frustrated with its limitations."

Source: http://www.technewsworld.com/rsstory/79214.html
Category: CDOT   Jodi Arias   Erwin Schrödinger   Betty Pino   food network star  

Peterson attended son's funeral on Wednesday

Minnesota Vikings running back Adrian Peterson pauses during introductions before an NFL football game against the Carolina Panthers in Minneapolis, Sunday, Oct. 13, 2013. One of the star running back's sons, a 2-year-old in South Dakota, died Friday after an alleged attack in a child abuse case. (AP Photo/Michael Conroy)

Minnesota Vikings running back Adrian Peterson pauses during introductions before an NFL football game against the Carolina Panthers in Minneapolis, Sunday, Oct. 13, 2013. One of the star running back's sons, a 2-year-old in South Dakota, died Friday after an alleged attack in a child abuse case. (AP Photo/Michael Conroy)

FILE - In this Oct. 11, 2013 file photo, Joseph Patterson, who is charged with aggravated assault and aggravated battery on an infant, leaves the Lincoln County Courthouse after a hearing in Canton, S.D. Prosecutors expect to ask a grand jury to consider more serious charges against Patterson in the death of the 2-year-old son of Minnesota Vikings running back Adrian Peterson. Lincoln County State's Attorney Tom Wollman says he will review the completed autopsy report along with other reports before seeking any new charges against Patterson. Sioux Falls police identified the boy as Tyrese Robert Doohen, who died Friday, Oct. 11, 2013 after being hospitalized with severe head injuries. (AP Photo/Argus Leader, Joe Ahlquist) NO SALES

Minnesota Vikings fans hold a sign supporting Vikings running back Adrian Peterson during the second half of an NFL football game in Minneapolis, Sunday, Oct. 13, 2013. One of the star running back's sons, a 2-year-old in South Dakota, died Friday after an alleged attack in a child abuse case. The Carolina Panthers defeated the Vikings 35-10. (AP Photo/Jim Mone)

Family, friends and well-wishers gather in Sertoma Park in Sioux Falls, S.D., for a candlelight vigil in memory of Minnesota Vikings' Adrian Peterson's 2-year-old son on Friday, Oct. 11, 2013. Authorities said a 2-year-old boy died Friday of injuries suffered in an alleged child abuse case and a person with knowledge of the situation told The Associated Press the boy was Peterson's son. (AP Photo/Argus Leader, Jay Pickthorn) NO SALES

Joseph Patterson, center, who is charged with aggravated assault and aggravated battery on an infant, leaves the Lincoln County Courthouse after a hearing in Canton, S.D., on Friday, Oct. 11, 2013. Prosecutors and police in South Dakota declined to confirm that Minnesota Vikings running back Adrian Peterson is the father of a 2-year-old boy who was hospitalized with severe head injuries in Sioux Falls on Wednesday. Police described the child's condition as consistent with abuse. Patterson is accused in the case of the 2-year-old. (AP Photo/Argus Leader, Joe Ahlquist) NO SALES

EDEN PRAIRIE, Minn. (AP) — Two months ago, around the time the Minnesota Vikings were losing their second preseason game, Adrian Peterson was given some surprising news.

The star running back says he found out then he had a 2-year-old son living in Sioux Falls, S.D., named Tyrese Robert Ruffin. He had been working with Tyrese's mother to arrange a meeting with the boy when he received a call last week that the child was in the hospital with severe injuries.

Peterson raced to South Dakota last Thursday, where he saw little Tyrese for the first time. The boy died a day later in an alleged case of child abuse, and Peterson has been trying to come to grips with it ever since.

Peterson attended Tyrese's funeral Wednesday and returned to Minnesota for practice on Thursday. His voice wavered when he discussed Tyrese publicly for the first time, trying to grapple with mourning the death of a son he never got to know.

"I was planning on seeing him. I had a talk with his mom and we got some things together as far as financially helping her," Peterson said. "Unfortunately, this situation took place. It's devastating."

A man the boy's mother was dating, 27-year-old Joseph Patterson, is being held on charges of aggravated assault and aggravated battery. Tyrese died after Patterson was arrested, and prosecutors plan to convene a grand jury to consider more serious charges.

"It was a difficult day, just taking in the circumstance and the whole situation," Peterson said of the funeral. "A child was buried. That's difficult for anyone."

Peterson played against the Carolina Panthers on Sunday, rushing for 62 yards on 10 carries in a 35-10 loss, and he plans to play against the New York Giants on Monday night. It's been a theme for Peterson for nearly his entire life — football has been a refuge in difficult times ever since he was a youth.

"A lot of people won't ever understand the situation that I'm in and see it the way I'm seeing the situation," he said. "It's tough, but I'm able to deal with that and got a good supporting cast around me that's been supporting me through this tough time."

Peterson thanked his teammates and the Vikings organization for their support.

"They've been great, organization, teammates, they've been supporting me as well," he said. "I can't tell you how many calls I've gotten and texts from the guys up top in the organization and players just making sure that I'm OK and I'm doing well."

He has always prided himself on finding the positivity even in the darkest of times — and now he finds himself searching again.

"I'm standing strong, man. I am," Peterson said. "My main focus has been on my son and their family down there in Sioux Falls. Just trying to wrap my head around things and trying to stay focused and play ball as well. So things have been tough, but I can handle a lot. I'm built for anything that comes my way. This right here will pass."

Peterson said he has been in touch with authorities in South Dakota to stay on top of the proceedings and didn't expect to miss any more time this season to deal with the situation.

"I have the contacts that I need to be able to stay involved as far as the investigation," he said.

NOTES: Peterson only practiced on a limited basis on Thursday because of a sore hamstring. ... K Blair Walsh (left hamstring), S Harrison Smith (turf toe on left foot) and CB A.J. Jefferson (right ankle) did not practice.

Associated PressSource: http://hosted2.ap.org/APDEFAULT/347875155d53465d95cec892aeb06419/Article_2013-10-17-FBN-Vikings-Peterson/id-04624adaba2647d8a08c4b0c91fd0100
Related Topics: glee   scarlett johansson   reggie bush   Amish Mafia   Erbie Bowser  

What’s the Point of Finding Cancer Mutations?

Hepatocellular cancer of a liver, magnified 200 times.

Image by BonD80/Shutterstock

Here’s an honest question: What is the point of knowing that a gene called KRAS is mutated in many colorectal cancers? Or knowing that p53 is mutated in several types of cancer? Or knowing any of the hundreds of genetic mutations that appear in tumor cells across the land? Unless you work in an academic or industry laboratory, what is the use of knowing the genetic mutation responsible for a cancer? For almost every known cancer mutation, there is no drug to match it with.

The understanding that genetic mutations are linked to cancer is decades-old; the first human oncogenes (genes that trigger cancer) were found in the early 1980s. The exponential growth of cancer genomics is the legacy of the Human Genome Project and spin-off projects like the Cancer Genome Atlas, a publicly funded, collaborative project to parse the genetic underpinnings of cancer, as well as technological advances that allow rapid extraction of genetic information. A single DNA sequencer can now accomplish in a day what took 10 years for the Human Genome Project—and for thousands of dollars per genome, versus $100 million in the olden days of the 1990s. The deluge in genetic information will continue for some time.

The most famous abnormalities are variations of the BRCA gene known as BRCA1 and BRCA2, which can gravely increase the risk of breast and ovarian cancer. These mutations are usually inherited. But cancer genomics has uncovered hundreds of genetic mutations that arise spontaneously during a lifetime. These abnormalities can’t be predicted or prevented—or, on the plus side, passed on to one’s children. There’s SF3B1 in myelodysplastic syndrome, a type of blood cancer. Abnormalities in a gene called FLT3 (pronounced flit-3) are common among patients with acute myeloid leukemia. Many brain tumors have abnormal IDH1 genes. Mutated versions of MLL2 and MLL3 have been found in medulloblastoma, non-Hodgkin lymphoma, prostate cancer, and breast cancer (PDF). And on and on.

Science has come far in deciphering not only what genes are mutated in what cancers, but also how and when the changes arise. The knowledge is remarkably specific. According to recent research, the most common solid tumors (that is, cancer that occurs as clusters of cells in or on organs, rather than in liquid form within the blood or lymphatic system) have up to 66 mutations that influence how the cancer cells operate—how fast they divide, whether they are susceptible to the signals that would normally cause a cell to die, when they detach from the main tumor to colonize another organ in the body, when and where they attach blood vessels to healthy tissues. Most of the functions that allow cancer cells to flourish are made possible by genetic mutations.

All told, about 140 genes have been found that, when mutated, can drive the development and progress of cancer. These are the “driver mutations,” which are often accompanied by “passenger mutations,” abnormalities that occur as cancer progresses but do not spur the disease. Most tumors contain fewer than 10 of the driver mutations, but the number of total mutations—passenger and driver—can climb far higher, from a dozen or so in neuroblastoma to approximately 200 in lung cancer.

The reason cancer-causing mutations occur follows a cold logic. Simply, it’s largely a matter of odds. When a cell divides, its DNA double helix unzips so that the genome can be copied, one for each of the daughter cells. (Here’s an explanation in rap.) Our genetic information is encoded by the nucleotides thymine, cytosine, guanine, and adenosine, abbreviated as T, C, G, and A, respectively. Each of our 20,000 or so genes is made up of a sequence of those bases. Strung together and squished into chromosomes, our genome contains a total of 3 billion bases. The Human Genome Project produced reams of data that look like this: TCGGGAAATTCGATCCCCAAAATTCTA, etc. (You can see genetic sequences online here.)

That’s the miracle of life, or one of them. Every single cell in our bodies contains a complete copy of the human genome. If you unwound the DNA from all these cells, it would reach to the sun and back 400 times. And every time a new cell is made, which is often—about 10 trillion times in a lifetime—the genome is copied, from the moment of conception to the moment we shuffle off this mortal helix.

That’s a lot of T’s, C’s, G’s, and A’s, and sometimes mistakes happen during replication. Sometimes a C is substituted for a G. Sometimes a few bases don’t get copied. Sometimes a sequence of a few bases gets copied in reverse order. That’s what genetic mutations are. Errors.

Sometimes the change, even of a single base, is enough to cause damage. The mutant gene—APC in colon cancer, for example—encodes a mutant protein that enables the single cell housing the mutation to grow at a faster pace than any of the cells surrounding it. At first, the change is minimal. But with cells growing and dividing more rapidly, the odds of another mutation are higher. So then one day, a cell with the APC mutation also gets a KRAS mutation, and now the dually mutated cells grow even faster. Soon enough, one of those cells gets a PIK3CA mutation, and now the cell is able to burrow into the colon walls, or find its way to a lymph node, or depart the mother ship for the liver.

It’s a matter of odds: The more cells you have, the greater the chance of a mistake, and the more mistakes that occur, the more likely it is that one of the mistakes will be harmful. Environmental influences may increase the likelihood of mutations. But so far, cigarette smoking is the only factor that is beyond debate. The fact is that because cancer cells reproduce more rapidly than any other cell in the body, mutations occur in cancer cells in far greater numbers. Before long, the cancer cell is abnormal enough that it takes on behaviors that eventually kill us.

That’s cancer. That’s all it is. It’s the result of speeding up a perfectly normal bodily process. As George Johnson puts it in The Cancer Chronicles, “Cancer is not a disease. It is a phenomenon.”

And that is why cancer genomics matters: not because of the information, but because of what the information tells us about this disease, which is diagnosed in about 12.7 million people worldwide every year. Keeping up with the information for information’s sake is futile and pointless for most of us. But taken together, the findings call for a shift in our overall thinking about cancer. That change in perception matters when it comes to understanding why so many members of the human race, let alone one’s family, continue to die of cancer. 

Source: http://www.slate.com/articles/health_and_science/human_genome/2013/10/cancer_mutations_genetic_studies_of_tumors_have_not_led_to_many_drugs.html
Category: The Blacklist   Kaepernick   powerball winning numbers   Snowden   Ross Lynch  

Review: Salt keeps server automation simple

October 17, 2013

Like Puppet, Chef, and Ansible, Salt is an open source server management and automation solution with commercial, officially supported options. Based on command-line-driven server and client services and utilities, Salt is primarily focused on Linux and Unix server management, though it offers significant Windows management capabilities as well. While Salt may look simple on its face, it's surprisingly powerful and extensible, and it has been designed to handle extremely large numbers of clients.

Salt uses a push method of communication with clients by default, though there's also a means to use SSH rather than locally installed clients. Using the default push method, the clients don't actively check in with a master server; rather, the master server reaches out to control or modify each client based on commands issued manually or through scheduling. But again, Salt can also operate in the other direction, with clients querying the master for updates. Salt functions asynchronously, and as such, it's very fast. It also incorporates an asynchronous file server for file deployments.

[ Review: Ansible orchestration is a veteran Unix admin's dream | Review: Chef cooks up configuration management | Review: Puppet Enterprise 3.0 pulls more strings | Puppet or Chef: The configuration management dilemma | Subscribe to InfoWorld's Data Center newsletter to stay on top of the latest developments. ]

To continue reading, register here to become an Insider

It's FREE to join

Source: http://podcasts.infoworld.com/d/data-center/review-salt-keeps-server-automation-simple-228936?source=rss_infoworld_top_stories_
Related Topics: Alexian Lien   lsu football   indicted   Larry Shippers   Sinkhole In Florida  

Libyan pleads not guilty to terrorism charges

In this courtroom sketch, Abu Anas al-Libi, 49, second from left, sits as his lawyer David Patton, second from right, address Judge Lewis Kaplan, far right, in a federal courtroom in New York, Tuesday, Oct. 15, 2013. Abu Anas al-Libi, a Libyan, pleaded not guilty to terrorism charges in the deadly 1998 al-Qaida bombings of U.S. embassies in Africa. (AP Photo/Elizabeth Williams)

In this courtroom sketch, Abu Anas al-Libi, 49, second from left, sits as his lawyer David Patton, second from right, address Judge Lewis Kaplan, far right, in a federal courtroom in New York, Tuesday, Oct. 15, 2013. Abu Anas al-Libi, a Libyan, pleaded not guilty to terrorism charges in the deadly 1998 al-Qaida bombings of U.S. embassies in Africa. (AP Photo/Elizabeth Williams)

FILE - This file image from the FBI website shows Anas al-Libi, an al-Qaeda leader connected to the 1998 embassy bombings in eastern Africa and wanted by the United States for more than a decade. Gunmen in a three-car convoy seized Nazih Abdul-Hamed al-Ruqai, known by his alias Anas al-Libi, outside his house Saturday, Oct. 5, 2013, in the Libyan capital, his relatives said. Two law enforcement officials say a team of U.S. investigators from the military, the intelligence community and the Justice Department has been deployed to question Abu Anas al-Libi, according to two law enforcement officials. (AP Photo/FBI, File)

In this courtroom sketch, Abu Anas al-Libi, 49, right, is lead away after answering terrorism charges in a federal courtroom in New York, Tuesday, Oct. 15, 2013. Abu Anas al-Libi, a Libyan, pleaded not guilty to terrorism charges in the deadly 1998 al-Qaida bombings of U.S. embassies in Africa. (AP Photo/Elizabeth Williams)

In this courtroom sketch, Abu Anas al-Libi, 49, sits as his lawyer David Patton, right, address a federal court in New York, Tuesday, Oct. 15, 2013. Abu Anas al-Libi, a Libyan, pleaded not guilty to terrorism charges in the deadly 1998 al-Qaida bombings of U.S. embassies in Africa. (AP Photo/Elizabeth Williams)

NEW YORK (AP) — An alleged al-Qaida member who was snatched off the streets in Libya and interrogated for a week aboard an American warship pleaded not guilty to bombing-related charges Tuesday in a case that has renewed the debate over how quickly terrorism suspects should be turned over to the U.S. courts.

Despite calls from Republicans in Congress to send him to Guantanamo Bay for indefinite interrogation, Abu Anas al-Libi became the latest alleged terrorist to face civilian prosecution in federal court in New York, the scene of several such convictions.

Al-Libi, wearing a thick gray beard, looked frail and moved slowly as he was led into the heavily guarded courtroom in handcuffs. An attorney said he had come to court from a New York hospital, where he was treated for three days for hepatitis C and swollen limbs.

The 49-year-old al-Libi was captured by American commandos during an Oct. 5 military raid in Libya and questioned for a week aboard the USS San Antonio.

He was indicted more than a decade ago in the twin 1998 bombings at the U.S. embassies in Kenya and Tanzania that killed 224 people, including a dozen Americans. If convicted, he could get life behind bars.

Known as one of al-Qaida's early computer experts, al-Libi is accused of helping plan and conduct surveillance for the attacks. He is believed to have used an early-generation Apple computer to assemble surveillance photographs.

The defendant kept his hands folded on his lap as the judge read the charges in a courtroom secured by about a dozen deputy U.S. marshals. The judge ordered him detained after a federal prosecutor called him a "clear danger."

Republicans stepped up their criticism of Obama for his administration's handling of al-Libi, saying he should have been sent to the American prison at Guantanamo Bay for more interrogation instead of being taken to the U.S. and given access to civilian courts and the legal protections they provide.

"He was a treasure trove of information," said Sen. Lindsey Graham of South Carolina.

"The most dangerous thing we could do as a nation is to treat a captured al-Qaida terrorist as a common criminal, read them their Miranda rights and put them in civilian court before we have a chance to gather intelligence."

New York Republican Rep. Peter King, a member of the House Intelligence Committee, said: "The real issue is the intelligence. Once he gets a lawyer, he holds the cards. ... Put it this way: Now he decides whether he will talk."

Democratic Sen. Patrick Leahy of Vermont defended the administration, saying dozens of terrorists have been arrested and continued providing information.

"Wouldn't it be nice if we demonstrated to the rest of the world that we're not afraid of these people, that we have the best court systems in the world and we're going to use them?" he said.

Al-Libi's family and former associates have denied he was ever a member of al-Qaida.

"The presumption of innocence is not a small technicality here," his court-appointed attorney, David Patton, said in email sent after the hearing. In a 150-page indictment, al-Libi "is mentioned in a mere three paragraphs relating to conduct in 1993 and 1994 and nothing since. ... There is no allegation that he had any connection to al-Qaida after 1994, and he is eager to move forward with the legal process in this case."

Al-Libi's lawyer also said the defendant goes by the name Nazih Abdul-Hamed al-Ruqai.

The prosecution in the United States is in keeping with a policy of bringing suspected al-Qaida sympathizers and operatives to civilian courts rather than military tribunals.

The civilian court prosecutions have continued before and after the Obama administration was forced to reverse its plans to prosecute 9/11 mastermind Khalid Sheikh Mohammed and several others in federal court in Manhattan.

Before the Sept. 11 attacks, several other major terrorism trials were held in New York, including those of blind Egyptian sheik Omar Abdel-Rahman and Ramzi Yousef, who was the architect of the 1993 World Trade Center bombing.

Just weeks before 9/11, four men were convicted in the embassy bombings and were sentenced to life in prison, two of them after a jury rejected the death penalty.

___

Associated Press writers Bradley Klapper and Eileen Sullivan in Washington and Frank Eltman on Long Island contributed to this report.

Associated PressSource: http://hosted2.ap.org/APDEFAULT/386c25518f464186bf7a2ac026580ce7/Article_2013-10-15-Terror%20Trials/id-0a0ef4cf0dd543c3bb3b6f34f9e241f9
Similar Articles: elizabeth berkley   Merritt Wever   dancing with the stars   Sarin gas   Dufnering  

John Mayer's Love Life in 6 Photos

John Mayer has never sustained a relationship for more than a year, and he's been known to give really embarrassing interviews about his exes. Nevertheless, women can't help falling in love with the temperamental singer-songwriter.

Source: http://www.ivillage.com/john-mayers-love-life-6-photos/1-a-549581?dst=iv%3AiVillage%3Ajohn-mayers-love-life-6-photos-549581
Related Topics: Daft Punk   mila kunis   lea michele   Flossie   Lincoln Memorial  

In slap, Ted Cruz's hometown newspaper rethinks its endorsement (Los Angeles Times)

Share With Friends: | | Politics - Top Stories Stories, News Feeds and News via Feedzilla.

Source: http://news.feedzilla.com/en_us/stories/politics/top-stories/334512092?client_source=feed&format=rss
Related Topics: kanye west   futurama   Betty Pino   Anastasia Ashley   regions  

Report: Amazon's HTC Phone Might Just Be For Prime Members

Rumor has it Amazon is talking to HTC about making its smartphone, and according to a Bloomberg report, that phone might just be for Amazon Prime subscribers.

Citing unnamed sources, Bloomberg said Amazon wants a phone because it wants to increase the number of devices on which people could access Amazon Instant Video. So the incentive here would be to buy a Prime subscription and get a phone for very, very cheap if not free. That certainly fits in with the Amazon model of inexpensive devices that are deeply tied to its for-pay streaming content service. Bloomberg also said that Amazon isn't totally sure it wants to make a phone yet, but the rumors make it seem like it's not outside the realm of possibility. [Bloomberg]

Source: http://gizmodo.com/report-amazons-htc-phone-might-just-be-for-prime-memb-1446594130
Similar Articles: packers   ny times   us open tennis   lil kim   VMAs  

Milian on her 'DWTS' exit: I don't blame Hough

TV

Michael Maloney
TODAY contributor

10 hours ago

Craig Sjodin / ABC

Christina Milian and "Dancing With the Stars" pro Mark Ballas.

"Dancing With the Stars" pro Mark Ballas didn’t do the press line after getting booted from the ballroom alongside star Christina Milian on Monday night. The two-time mirror ball champion wasn’t planning on being ousted, and since the ejected duo leaves immediately for a New York media tour, Ballas had to go home and quickly pack some clothes.

As for his celebrity partner, Milian spoke to the media after the live broadcast about her surprise expulsion from the reality competition.

“I was shocked, for sure,” she told TODAY. “I’m not saying it should have been anybody else, but to be honest, after having a great performance you feel a bit more confident.”

Milian and Ballas indeed had excellent reasons to believe they were safe. Head judge Len Goodman gave them the first 10 of the season for their cha-cha Monday, and the duo was tied with Corbin Bleu and his partner, Karina Smirnoff, at the top of the leaderboard with a score of 28.

So why were fan votes — the lack of which sent Milian and Ballas packing — so far out of line with the scores?

Maybe last week's brouhaha, caused when guest judge Julianne Hough joked that Ballas tends to outshine his dance partners, played a role.

“Who knows?” Milian said. “I don’t want to blame it on her, (but) she is very present. She has a presence and is very likable.”

Milian's cha-cha kicked off with a series of solo moves that, as it turns out, were in direct response to Hough's remark.

“Yes, that was on purpose, absolutely,” Milian confirmed to TODAY. “Mark said, ‘Okay, if she thinks I overshadow you, we’re going to have a whole intro with you dancing.’"

“Mark and Julianne go way back,” noted pro Cheryl Burke. “I thought (her remark) was kind of harsh, but they grew up together and are really close. Maybe it was an inside joke?”

But the joke, if it was one, is now behind them. Milian is now focused on her gratitude to Ballas.

“I told him he did such a great job and (our being voted off) has nothing to do with (him)," she said. "I wish I could be here longer, but I have no regrets.”

But she does have that sense of shock — over that unexpected ouster. Even Leah Remini, who was in jeopardy before Milian got the ballroom boot, was surprised.

“I thought, ‘Wow, the show must be fixed,’” the comedic actress deadpanned.

But when a another reporter asked Milian if she thought that was a possibility, she was quick to shoot it down.

"I don’t think it’s rigged at all," she insisted.

Source: http://www.today.com/entertainment/christina-milian-dwts-exit-i-dont-want-blame-it-julianne-8C11396229
Tags: penn state football   eric decker   Robin Quivers   detroit lions   Lady Gaga Vma  

Premiere: See Yeasayer's New Music Video Shot in the World's Trippiest Laboratory

The tower of Naturalis in the Dutch province of Leiden is like something sprung from the mind of Terry Gilliam: seven stories of shelves lined with preserved animals, insects, and fossils. Row upon row of jars containing discomfiting specimens. The tower houses the largest collection of natural history objects in Holland, and it’s sealed from the public — unless you’re Ruben van Leer, and you want to film the music video for the latest Yeasayer single, “Glass of the Microscope.” In which case you get the whole place to yourself.

“For a moment, among these scientific objects, we felt the entire history of the city,” van Leer, a Dutch filmmaker and artist, told WIRED. “We wanted to fuse that history with ideas of an evolutionary future. After technology saves the world — as Silicon Valley wants us to believe — what then?”

The last track on Yeasayer’s acclaimed 2012 album Fragrant World, “Glass of the Microscope” is heavy with the band’s characteristic silky synths and torpid melodies. There’s a post-apocalyptic vibe in the video that is subtle but persistent, imagining band members Chris Keating, Ira Wolf Tuton, and Anand Wilder as scientists struggling to find a cure for an unnamed global affliction. In addition to the Naturalis tower, the band filmed in molecular biologist Hans Tanke’s lab at Leiden University, one of the oldest research universities in Europe and the place where the 17th-century Dutch microbiologist Antoine van Leeuwenhoek developed an early prototype of the electron microscope.

Van Leer specializes in the refraction of the scientific through art. His in-progress opera film, Symmetry, was the first project selected by the arts@CERN program in Geneva, where he spent time shooting film at the Large Hadron Collider and thinking about how concepts in high-energy particle physics inform narratives of bodies in motion on a macroscopic scale.

“Through technology, we can observe our world from an increasing number of perspectives, and interact with its data,” said van Leer. “In this way, storytelling becomes a part of reality. Pop culture becomes science becomes culture again.”

There’s a tension between analog and digital — as well as the scientific and the philosophical — throughout the new video, which layers film shot through microscopes with 3-D computer animation created using a Microsoft Kinect motion sensor camera. As objects preserved in jars merge with objects pressed between plates of glass beneath the microscope, human bodies dance through those same microscopic images.

“What if the causes of certain material manifestations that seem so big in our world can be found on a microscopic scale within ourselves?” asked van Leer. “Through the pressure and response of our environment, we’ll be forced to think in more symbiotic ways.” In the end, this cure for what ails the world is “left to the imagination of the audience.”

A final, delicious fact about van Leer: his father is the lead vocalist and guitarist for the prog-rock group Focus, whose instrumental cut “Hocus Pocus” blew up in the U.S. in the early ’70s. As a kid, van Leer says he would ask his father why he became a musician, and his dad would reply, “I make music for the spheres.” Van Leer is similarly enigmatic when he speaks about his own work and what he hopes to achieve with it. “The power of art, for me, lies in aspiration,” he said. “We already have the power to create. What world will we make?”

Source: http://feeds.wired.com/c/35185/f/661370/s/328744bd/sc/38/l/0L0Swired0N0Cunderwire0C20A130C10A0Cyeasayer0Eglass0Emicroscope0Evideo0C/story01.htm
Related Topics: Emmy Winners 2013   Anna Gunn   Scott Eastwood   Niall Horan   Gia Allemand Dead  

Snooki and JWoww Team Up for "Extra"

Promoting their spinoff reality show, Nicole "Snooki" Polizzi and Jenni “JWoww” Farley headed to "Extra" in Universal City, California on Tuesday (October 15).

The pint-sized realty star wore a pretty white and black blouse with black pants while her bestie dwarfed her in a black top, tan jacket, and jeans.

Though the new season of "Snooki and JWoww" doesn't air for another week, fans can get their dose of Nicole on "Dancing with the Stars."

Last night, Snooki celebrated the most memorable year of her life by dancing in honor of her baby boy, Lorenzo.

Source: http://celebrity-gossip.net/nicole-polizzi/snooki-and-jwoww-team-extra-943282
Category: floyd mayweather   sunday night football   whitney houston   H&m   Aaron Paul  

Will Danaher (DHR) Disappoint This Earnings Season?

Danaher Corporation(DHR) is set to report third quarter 2013 results before the opening bell on Oct 17. Last quarter, Danaher posted a 2.35% positive earnings surprise. Let’s see how things are shaping up for this announcement.

Factors this Past Quarter

Danaher is affected by the poor macroeconomic conditions. The instability in Western Europe has also proved to be a drag for the company. Danaher’s Test & Measurement Tools segment has been affected by a weaker-than-expected product demand, leading to decreased margin expectations in the segment. The company’s operating cash flow had decreased in the quarter driven by increasing capital expenditures. Danaher had provided a tepid outlook for the third quarter and forecasted earnings to be in the range of 78 cents to 83 cents a share.

Earnings Whispers?

Our proven model does not conclusively show that Danaher is likely to beat earnings this quarter. That is because a stock needs to have both a positive Earnings ESP and a Zacks Rank of #1, 2 or 3 for this to happen. That is not the case here as you will see below.

Negative Zacks ESP:  That is because the Most Accurate estimate stands at 82 cents while the Zacks Consensus Estimate is at 83 cents. That is a difference of -1.21%.

Zacks Rank #3 (Hold): Danaher’s Zacks Rank #3 (Hold) lowers the predictive power of ESP because the Zacks Rank #3 when combined with a negative ESP makes surprise prediction difficult. We caution against stocks with Zacks Ranks #4 and #5 (Sell rated stocks) going into the earnings announcement, especially when the company is seeing negative estimate revisions momentum.

Other Stocks to Consider

Here are some other companies you may want to consider as our model shows that they have the right combination of elements to post an earnings beat this quarter:  

Spansion Inc. (CODE),with Earnings ESP of +6.67% and a Zacks Rank #1 (Strong Buy).

Micron Technology Inc. (MU),with Earnings ESP of +11.63% and a Zacks Rank #2 (Buy).

Honeywell International Inc. (HON), with Earnings ESP of +0.81% and a Zacks Rank #2 (Buy).

Read the Full Research Report on DHR
Read the Full Research Report on HON
Read the Full Research Report on MU
Read the Full Research Report on CODE

Zacks Investment Research

Source: http://news.yahoo.com/danaher-dhr-disappoint-earnings-season-160003022.html
Category: Ian Somerhalder   GTA Online   grandparents day   eminem   Boston Magazine  

Mimobot Mr. Sulu USB 3.0 (32GB)

Star Trek has long been a part of the Mimobot pantheon of flash drives, with drives modelled after Captain Kirk, Mr. Spock, Captain Picard and Data. Now we have the Mimobot Mr. Sulu USB 3.0 (32GB). The latest drive resembling a pop culture icon adds not only a beloved Star Trek character, but throws in USB 3.0 as well. The Mr. Sulu Mimobot flash drive offers a faster drive with higher capacity that we've seen on past Mimobot drives, and throws in a bunch of Sulu-centric extras for you or the Trekkie in your life.

Design and Features

The Mr. Sulu Mimobot flash drive uses the basic Mimobot design—a big, elongated head, which doubles as the USB plug cap, and a small body at one end. In this case, that head vaguely resembles George Takei circa-1968 (though, thanks to the cartoony art, you can imagine it's John Cho just as easily). Sulu is decked out in the gold shirt befitting a command officer, complete with a lieutenant's stripe at the wrist. While most Mimobot figures are depicted with their hands at their sides, Mr. Sulu breaks the mold by brandishing a phaser, though it's only printed onto the drive.

Remove the top of Mr. Sulu's head, and you'll uncap a USB 3.0 connector, easily identified by the light blue plug. On the back of the drive is a small LED indicator, which glows when the drive is plugged into a port. While the Mr. Sulu design comes in 8, 16, 32, and 64GB capacities, only the 32GB model offers USB 3.0.

Mimobot likes to include some extras for fans, and the Sulu-drive comes with plenty. A collection of wallpapers let you put some Star Trek-flavored wallpapers on your PC, tablet, or phone, and a half-dozen custom file icons and avatars let you decorate your data with Starfleet insignias, images of the Sulu drive, and even a cartoony rendering of a swashbuckling Sulu, rapier in hand. The drive also comes equipped with MimoByte sound software, which lets you set any number of Star Trek sounds and clips of Sulu dialogue when connecting or disconnecting the drive.

The 32GB Mr. Sulu Mimobot drive has a list price of $49.95, which works out to $1.56 per GB. For a USB 3.0 drive, this isn't half bad; the Editors' Choice SanDisk Extreme 3.0 (64GB) has a list price of $149.99, or $2.34 per GB. It's also a pretty good price for a novelty drive. The assorted Mimobot USB 2.0 drives we reviewed a few months back offered slower speeds and only 8GB of storage for a list price of $24.95, which works out to roughly $3.11 per GB, and the 4GB Dane-Elec Marvel Universe USB Drives drives sell for a similar $3.37 per GB.

Performance

The Mr. Sulu Mimobot flash drive is formatted in FAT32, so the drive can be used with any major operating system—Windows, Mac, and Linux are all support. The extra content, with the Sulu-themed icons and sounds, however, is Windows and Mac only. Mimobot covers the Mr. Sulu drive with a one-year warranty, which is a bit short for portable storage—many competitors offer three- or five-year warranties.

When tested, the Mr. Sulu drive offered the best performance we've seen of any novelty drive, due entirely to the availability of USB 3.0. In our timed data transfer test, the Mr. Sulu drive offered performance of 81 MBps (read) and 17 MBps (write) using USB 3.0. Compared to our leading USB 3.0 drive, the Editors' Choice SanDisk Extreme USB 3.0 was faster with USB 3.0 speeds of 105 MBps (read) and 110 MBps (write). While the Mr. Sulu drive shouldn't be purchased solely on its performance, it is significantly faster than the USB 2.0 alternatives.

Under USB 2.0 Mr. Sulu actually led the pack, with 31 MBps (read) and 12 MBps (write). By comparison, the assorted My Little Pony, Elvis Presley and Abraham Lincoln drives were even slower, with speeds of 27 MBps (Read) and 5 MBps (Write), and the Marvel Universe drives weren't any better at 30MBps (read) and 4MBps (write). All of these drives are passable given that they are generally cheaply sourced flash modules dressed up in goofy plastic enclosures, sold for fan-appeal rather than the merits of the hardware.

While most novelty flash drives offer little more than a nifty design showcasing a fan-favorite character, the Mr. Sulu Mimobot flash drive rises to new heights by offering a drive that has sizable storage and (relatively) strong performance. While George Takei's cartoon likeness won't appeal to everyone, the Mr. Sulu Mimobot is one geek-friendly drive that does more than just show off your favorite sci-fi franchise, it's also a pretty good drive on its own merits. For optimum performance, stick to our Editors' Choice SanDisk Extreme 3.0 (64GB), but for any fan of classic Star Trek, the Sulu drive is the way to go.

Source: http://feedproxy.google.com/~r/ziffdavis/pcmag/~3/jnGBm-I_VJg/0,2817,2425803,00.asp
Tags: elizabeth berkley   Michelle Rodriguez   parenthood   loretta lynn   nate robinson  

Study to Examine How Second Screens Impact Viewers and Creative Process

NATPE and the Consumer Electronics Association are jointly backing what they say will be the first study to measure how second-screen devices interact with TV programming and how that impacts consumers and the creative process.

The study -- to be released in two parts -- is expected to demonstrate ways the content and technology industries can enhance viewer engagement, improve the user experience and increase revenue in the future.

“Second screen” refers to a secondary device such as a tablet computer, smartphone or laptop that a viewer uses while watching a television program, allowing them at times to interact with and comment on what they are watching.

PHOTOS: What TV Viewers Really Want 

“Consumer electronics technologies are disrupting the traditional ways consumers view and engage with their favorite television programs,” said CEA CEO Gary Shapiro, adding that they hope this study will help content creators and the electronics industry understand how to work in this new environment.

“This research marks the intersection between the technology being showcased at CES and the content being celebrated at NATPE,” said NATPE CEO Rod Perth. “It’s a great opportunity for both the technology and creative communities to gain valuable insight about the changes in the media landscape and harness the potential of second screen from both sides of the equation.”

Perth said this also marks the expansion of the relationship between CEA and NATPE. CEA puts on the annual Consumer Electronics Show in Las Vegas, which attracts over 100,000 each January to view the latest in electronics technology and distribution devices. NATPE, held at the end of January in Miami Beach, draws over 5,000 people from the worlds of TV syndication, international distribution and digital media.

STORY: Study: Only 14 Percent of Cable Customers Satisfied; 73 Percent Want a la Carte 

The first part of the study, an online quantitative examination of U.S. TV viewers who use a second-screen device, will be presented at CES (Jan. 7-10, 2014), while the second part -- qualitative research on TV producers and showrunners -- will debut during NATPE (Jan. 27-29, 2014).

The study is being conducted by E-Poll Market Research, which has been conducting qualitative and quantitative research for television networks, producers, media agencies and advertisers for more than 15 years.

Source: http://feedproxy.google.com/~r/thr/business/~3/ekFDf1aadYQ/story01.htm
Tags: freedom tower   rafael nadal   Sloane Stephens   Rosy Esparza   Garrett Clayton  

Every Outfit Walter White Ever Wore in Breaking Bad

Breaking Bad tributes aren't hard to find. We've seen an entire episode translated into emoji. We've seen the show's theme played on equipment from a meth lab. We've even seen a Breaking Bad Lego set. But this new website might be the most obsessive tribute yet.

Read more...

Source: http://gizmodo.com/every-outfit-walter-white-ever-wore-in-breaking-bad-1445561680
Tags: seattle seahawks   Don Jon   mila kunis   EverQuest Next   Amanda Berry  

Starting today, you can preview Flickr's new picture viewer, with a 25% bigger picture that pushes t

Starting today, you can preview Flickr's new picture viewer, with a 25% bigger picture that pushes the info bar off to the side. It's the latest addition to the full-site redesign from earlier this year. [Flickr Blog via VentureBeat]

Read more...

Source: http://feeds.gawker.com/~r/gizmodo/full/~3/ENrb41966z4/starting-today-you-can-preview-flickrs-new-picture-vie-1445564963
Tags: patriots   Dylan Penn   What Does the Fox Say   Amanda Dufner   Eileen Brennan  

US-Afghan officials near a deal on American troops

U.S. Secretary of State John Kerry, left, leans in toward Afghan President Hamid Karzai as they say goodbye at the end of a news conference announcing a tentative agreement between the two countries at the Presidential Palace during Kerry's unannounced stop in Kabul, Afghanistan, on Saturday, Oct. 12, 2013, as a deadline approaches for a security deal about the future of U.S. troops in the country. (AP Photo/Jacquelyn Martin, Pool)

U.S. Secretary of State John Kerry, left, leans in toward Afghan President Hamid Karzai as they say goodbye at the end of a news conference announcing a tentative agreement between the two countries at the Presidential Palace during Kerry's unannounced stop in Kabul, Afghanistan, on Saturday, Oct. 12, 2013, as a deadline approaches for a security deal about the future of U.S. troops in the country. (AP Photo/Jacquelyn Martin, Pool)

U.S. Secretary of State John Kerry paces while on a mobile phone call from the second story of the Afghan Presidential Palace during a break in an extended meeting with Afghan President Hamid Karzai at the palace during an unannounced stop in Kabul, Afghanistan, on Saturday, Oct. 12, 2013, as a deadline approaches for a security deal about the future of U.S. troops in the country. (AP Photo/Jacquelyn Martin, Pool)

U.S. Secretary of State John Kerry, left, turns with Afghan President Hamid Karzai as they say goodbye at the end of a news conference announcing a tentative agreement between the two countries at the Presidential Palace during Kerry's unannounced stop in Kabul, Afghanistan, on Saturday, Oct. 12, 2013, as a deadline approaches for a security deal about the future of U.S. troops in the country. (AP Photo/Jacquelyn Martin, Pool)

U.S. Secretary of State John Kerry leaves ISAF Headquarters as he leaves Afghanistan after announcing with Afghan President Hamid Karzai that they've reached a tentative agreement in Kabul, Afghanistan, on Saturday, Oct. 12, 2013, as a deadline approaches for a security deal about the future of U.S. troops in the country. (AP Photo/Jacquelyn Martin, Pool)

Afghan President Hamid Karzai, right, points toward U.S. Secretary of State John Kerry as he jokes with him at the start of a news conference at the Presidential Palace during Kerry's unannounced stop in Kabul, Afghanistan, on Saturday, Oct. 12, 2013, as a deadline approaches for a security deal about the future of U.S. troops in the country. (AP Photo/Jacquelyn Martin, Pool)

KABUL, Afghanistan (AP) — The U.S. and Afghan President Hamid Karzai reached an agreement in principle Saturday on the major elements of a deal that would allow American troops to stay in Afghanistan after 2014.

However, U.S. officials said a potentially deal-breaking issue of jurisdiction over those forces must still be worked out with some political and tribal leaders in Afghanistan.

U.S. officials traveling with U.S. Secretary of State John Kerry said the deal negotiated with Karzai meets all American conditions, including on the jurisdiction issue, and that all that remains is for Karzai to win political approval for it.

During the talks, Kerry made frequent phone calls back to Washington, speaking with Defense Secretary Chuck Hagel and national security adviser Susan Rice multiple times, the officials said.

The American contingent was hopeful that a national consultative assembly of tribal elders, or Loya Jirga, and the Afghan parliament would approve the agreement, the officials said. They requested anonymity because they were not authorized to discuss the agreement by name.

Kerry spoke with Karzai after a marathon series of meetings and repeated delays of Kerry's departure from Afghanistan. Both men later said agreement had been reached on a series of contentious sovereignty issues and the safety of Afghan citizens at the hands of American and allied troops that had deadlocked talks in the past year.

But Karzai said he would punt the issue of who has jurisdiction for any crimes committed by U.S. forces in Afghanistan after 2014 to the Loya Jirga that he has asked to be convened within a month. Their opinion on whether to approve or disapprove an American demand that its forces be remanded to U.S. military courts would then be sent to the Afghan parliament.

Kerry responded that any decision made by the Loya Jirga and parliament would be respected, but he added that if the jurisdiction issue was not resolved there would be no agreement.

In Iraq, a similar deal fell apart after U.S. officials were unable to reach an agreement with the Iraqis on the same issue that would have allowed a small training and counterterrorism force to remain there. The United States completely pulled out of Iraq after the deal collapsed.

The jurisdiction issue came to the fore after an American soldier, Staff Sgt. Robert Bales, killed 16 people in two villages in southern Afghanistan last year. He was convicted in August by a military court and sentenced to life in prison with no chance of release.

Kerry explained that the issue should not be equated with immunity, as it is perceived by many Afghans. He said the United States would prosecute any wrongdoing and that similar agreements existed with many countries, like Japan and South Korea.

Kerry began negotiations with Karzai in the morning, the second day of talks after he arrived late Friday. He left shortly after the last meeting, headed for Europe and the United States.

Discussions had repeatedly stalled in recent weeks over Karzai's demand for American guarantees against future foreign intervention from countries like Pakistan, and U.S. demands for any post-2014 residual force to be able to conduct counterterrorism and counterinsurgency operations.

The situation deteriorated in the past week following a series of angry comments from Karzai that the United States and NATO were repeatedly violating Afghanistan's sovereignty and inflicting suffering on its people.

Karzai has been reticent to sign a deal, worried about his legacy and possibly because of a lingering bitterness over what he considered as foreign meddling in the 2009 presidential vote that almost cost him the election. Having completed a second term, he is not eligible to run in the April 5 presidential elections.

He is keenly aware that previous leaders of his country historically have been punished for selling out to foreign interests and wants to make sure that any U.S.-Afghan agreement is not seen in that light.

There currently are an estimated 87,000 international troops in Afghanistan, including about 52,000 Americans. That number will be halved by February and all foreign combat troops will be gone by the end of next year.

The U.S. wants to keep as many as 10,000 troops in the country to go after the remnants of al-Qaida, but if no agreement is signed, all U.S. troops would have to leave by Dec. 31, 2014. President Barack Obama said in an interview with The Associated Press he would be comfortable with a full pullout of U.S. troops.

___

Associated Press writer Rahim Faiez contributed to this report.

Associated PressSource: http://hosted2.ap.org/APDEFAULT/cae69a7523db45408eeb2b3a98c0c9c5/Article_2013-10-13-Kerry-Afghanistan/id-40fffdfc39084a789f5b17f0be2e43d9
Tags: nobel peace prize   Ken Norton   yom kippur   NFL Sunday Ticket   yemen  

'Teen Beach Movie' Star Joins ABC Family's 'The Fosters' (Exclusive)

Getty Images

Garrett Clayton

A Teen Beach Movie reunion is on the horizon.

Actor Garrett Clayton, who starred with Maia Mitchell on Disney Channel's summer ratings hit, has landed a pivotal role on ABC Family's The Fosters, The Hollywood Reporter has learned exclusively.

Clayton has joined the hour-long drama in a recurring capacity as Chase, a handsome and charming high school senior who recruits Mariana (Cierra Ramirez) to join the crew of the school play. He first appears in the second episode of the winter season, which kicks off in January.

STORY: ABC Family Renews 'The Fosters' for Season 2

The casting comes days after ABC Family issued an early season two renewal for The Fosters. Rosie O'Donnell is also set to recur when the series returns for the remaining episodes of its freshman season.

Co-created by Bradley Bredeweg and Peter Paige, The Fosters follows a multicultural family led by two moms. Teri Polo, Sherri Saum, David Lambert, Jake T. Austin, Hayden Byerly, Danny Nucci co-star with Mitchell and Ramirez.

Executive producers are Jennifer Lopez, Joanna Johnson, Greg Gugliotta, Elaine Goldsmith Thomas, Benny Medina and John Ziffren on the Nuyorican/Prodco Inc. production.

Repped by Talent Works and Roar, Clayton has guest starred in The Client List, Shake It Up and Days of Our Lives and starred in the 2012 TV movie Holiday Spin.

E-mail: Philiana.Ng@THR.com
Twitter: @insidethetube

Source: http://feedproxy.google.com/~r/thr/television/~3/xVMSQS2W2_c/story01.htm
Category: Americas Cup   chrissy teigen   Colin Kaepernick   Betty Pino   Carlos Hyde